Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST27658
Clone ID OST27658
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST27658
Sequence
AGAGGACCAGTGCCAAGGCGACANGTCAATGTTCTGTAGGATGGAAGTCTTGTCTCGCTACTGCTCCATCCCCAGCTACA
ACAAGCTTTGCTGCAAGTCCTGCAACCCGCCCCGAAACCTCAGCAACACAGAGGACGGAGGTGTGGAGCCTCCTCCCGGG
AAGCACAATGACATCGATGTGTTCATGCCCACACTCCCGGGGCCCACTGTAGCTACACAGGTGCAGCCTTCTCCGGGGCC
TCCTTTGGAGGCTCCCCTCAATGTCTCTAGCACCAATGCCACTGAAGATCACCCAGAAACCAATGCTGTGGATGTCCCCT
ACAAAATCCATGGTGTGGATGAAGAAGGTCCCNCTTCTTAACCTGATCCCTCGACGGCCAAGCCTGTATGTAAAGACAAG
GAACCAAAGAATCC
Sequence Type mRNA
Unitrap ID UNI28572

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 50617069..50617481 400
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036545 (Adamts2) NM_175643 a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 2 Gene [Source:MGI (curated);Acc:Adamts2-001]

 
Come back to gene ENSMUSG00000036545


For any suggestions or comments, please send an email to unitrap@crg.es