Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST27344
Clone ID OST27344
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST27344
Sequence
GCCCGTGGCTCTTGGCTATAACCTGTTTGAGGGACGGCCTCAGCTGACAGCATGGCGAGAGAGGGTGGAGGCGTTCTTGG
GTGCTGAGCTGTGTCAGGAGGCTCATAGCACCATCCTGAGCATCCTGGGACAGGCAGCCAAGAAAATGTTACCAGTACCC
CCTCCGGAGGTCCATGCCAGCATGCAGCTTCGAATTGCTAGGATTCCTTGAGTGGTCTGACCAGCAATAAAGACTCATTT
TGTGTTTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI16112

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75294594..75294840 247
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033318 (Gstt2) NP_034491 glutathione S-transferase, theta 2 Gene [Source:MGI Symbol;Acc:MGI:106188]

 
Come back to gene ENSMUSG00000033318


For any suggestions or comments, please send an email to unitrap@crg.es