Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XJ208
Clone ID XJ208
Vector pGT1Lxf
Project baygenomics

Sequence tag XJ208
Sequence
AGCCAGTGTTTTCCATTGTACCCTGTGTGCTGGAAGCTGCCAAACAAGTGCGCTCTGAAAACCTGGAGGGGCTGGATGTT
TACATGCGCATCTTACAGCTGCTCACCACGGTGGATGACGGCGTGCAAGCCATC
Sequence Type mRNA
Unitrap ID UNI9417

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 53955007..53957202 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006763 (Saal1) NP_084509 serum amyloid A-like 1 Gene [Source:MGI (curated);Acc:Saal1-001]

 
Come back to gene ENSMUSG00000006763


For any suggestions or comments, please send an email to unitrap@crg.es