Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST26940
Clone ID OST26940
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST26940
Sequence
AAGGGCCCACATGGTTGAAAGATGACGAGGCAACACATTGTAAGCAGTGTGAGAAGGACTTCTCCATTTCTCGGAGGAAG
CACCACTGCCGAAACTGTGGCCACATTTTCTGCAACACCTGCTCTAGCAACGAGCTGGCCCTGCCCTCCTACCCTAAGCC
AGTGCGTGTGTGTGACAGCTGCCATACCCTGCTACTGCAGCGCTGCTCCTCCACTGCCTCCTGAAGCCATCAGCCCCACC
CACCAGCAGGGACCTTGACCTGTTGACCTCCATCCTCAGAGTGGAGGAAAGCCTCAGGTACAGTGCCAAACTTGGGATCT
CCAGAGACCTGTAGGGACCCAAGAGAATCAAAGGAAAGAATGAAACCTTCACCAGGCTGTCAGCCTCGGAAGAGAATGCC
AAGTGGCAGCTGAGCACTTTTCCATGGTCTCTATGGAGTCATCTCCTCTAGACAGACACTTCTGTGTCCTCAGTTAAATC
CTGGCTTTGGTACAGGTGCAACTTCATGACTTTGCTACTG
Sequence Type mRNA
Unitrap ID UNI28593

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 50203021..50203875 442
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020375 (Rufy1) NM_172557 RUN and FYVE domain containing 1 Gene [Source:MGI (curated);Acc:Rufy1-001]

 
Come back to gene ENSMUSG00000020375


For any suggestions or comments, please send an email to unitrap@crg.es