Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRD143
Clone ID RRD143
Vector pGT1Lxf
Project baygenomics

Sequence tag RRD143
Sequence
CATACGTTGTGCTCCGGTCTGGATCTCCGTGGAACTGAACTGTTTTACAAAGCAAACTTTACCGCGTGGCGACAACCTCT
AGGCGTGTACGACAGGCCTTCGGGTCCACTCCGAACACCAACTGGAGTCTGTAATTTTCAGTTTGCAAACTGTTCTCGAG
GCTGGTGAACAGCCACGCTCTGTATCCAAGAGCTGAGGACAGCATCAGCACACACTGTCTGCCAGCAGACTGAGATGGGA
CGGACATCTAAGGATAAACGGGATGTCTACTACCGCCTGGCCAAGGAGAATGGCTGGCGGGCCCGAAGCGCTTTCAAGCT
CCTGCAACTGGATGAGGAATTCCAACTCTTCAAAGGTGTGAAGCGAGCGGTTGACTTGTGTGCAGCCCCAGGCAGCTGGA
GCCAGGTGCTGAGCCAGAAGGTTGGGGGCCAGGGTTCTGGTCAGGTGGTGGCCGTGGACTTACAGGCTATGGCTCCACTG
CCAGGTGTGATACAGATACAGGGCGACATCACTCAGCTTTCCACTGCCAAGGAGATCATCCAGCACTTTGAAGGCTGCCC
TGCTGACCTAGTAGTGTGTGACGGGGCTCCTGAT
Sequence Type mRNA
Unitrap ID UNI9419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7826106..7829494 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031171 (Ftsj1) NM_133991 FtsJ homolog 1 (E. coli) Gene [Source:MGI (curated);Acc:Ftsj1-001]

 
Come back to gene ENSMUSG00000031171


For any suggestions or comments, please send an email to unitrap@crg.es