Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST26752
Clone ID OST26752
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST26752
Sequence
AACCCCTGCCCACTTGTGCTGACCAGTGATCAGGTCCTCCCCAGAAATAGATGAAGACCGGATCCCCAACTCACTTCTCA
AGTCCACCTTGTCAATGTCTCCACGGCAACGGAAGAAGATGACAAGGACCACACCCACCATGAAAGAGCTCCAGACGATG
GTTGAACATCACCTAGGGCAACAGAAGCAAGGGGAAGAACCTGAGGGAGCCACTGAGAGCACAGGGAACCAGGAGTCCTG
CCCACCTGGGATCCCAGACACAGGCTCGGCGTCAAGGCCAGATACCCCCGGGACAGCACAAAAGTCTGCAGAATCCAACC
CCAAGACTCAGGAGCAGTGTGGTGTGGAGCCCAGAACAGAGGATTCTTCAGCCCACATGCTACCACTGGATTCCCAGGGA
GCCAGCTTGGTCTGACAGAAGTTGGTATCCGGGGATCACCACTGCAGTGTGGAAATTCATGGACACTGGATGT
Sequence Type mRNA
Unitrap ID UNI28595

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 103361317..103364823 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022490 (Ppp1r1a) NM_021391 protein phosphatase 1, regulatory (inhibitor) subunit 1A Gene [Source:MGI Symbol;Acc:MGI:1889595]

 
Come back to gene ENSMUSG00000022490


For any suggestions or comments, please send an email to unitrap@crg.es