Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST26731
Clone ID OST26731
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST26731
Sequence
AAGAAGAAGCGCACCTTCCGCAAGTTACCTACCGTGGCGTAGACCTCGACCAACTGCTCGACATGTCCTATGAGCAACTG
ATGCAGCTGTACAGCGCCCGCCAGAGGAGGCGCCTGAACCGTGGTCTTCGGCGGAAGCAACACTCACTGCTCAAGCGCTT
GAGAAAGGCCAAAAAGGAGGCACCACCCATGGAGAAGCCTGAGGTGGTGAAGACGCACCTGAGGGACATGATCATCCTGC
CGGAGATGGTGGGTAGCATGGTGGGCGTGTACAACGGCAAGACCTTCAACCAGGTGGAGATCAAACCAGAGATGATCGGC
CACTACCTGGGCGAGTTCTCCATCACCTACAAACCCGTGAAGCACGGNCGGCCCGGGATCGGTGCCACCCACTCCTCCCG
ATTCATCCCCCTCAAGTAGCCGAGGCCAATAAAGACTGGTTTTGG
Sequence Type mRNA
Unitrap ID UNI16830

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 79755535..79756851 235
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063457 (Rps15) NM_009091 ribosomal protein S15 Gene [Source:MGI (curated);Acc:Rps15-001]

 
Come back to gene ENSMUSG00000063457


For any suggestions or comments, please send an email to unitrap@crg.es