Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRD189
Clone ID RRD189
Vector pGT1Lxf
Project baygenomics

Sequence tag RRD189
Sequence
ATGCAGAAGCTGCCGGTGCACATGGGCCTGTTGGTCACGGAGGAAGTGCAGGAGCCCAGCTTCTCAGACATCGCCAGCCT
CGTGGTGTGGTGTATGGCCGTGGGGATGTCCGACGTAAGAGTCTGCCGCCGGCTAGGTATTTTCAAGAGAAATAATTCCA
GATTGATGGATGAAATTTTAAAACAGCAACAGGAACTTTTGGGCCAAGATTGTTCCAAATACTCAGCAGAGTTTGCAAAT
AGTAATGACAAAGACGATCAAGATTTAAATTGCCCTTCGGCAGTGAAGGTGCTGTCCCCAGAAGATGGAAAAGCGGATAT
TGTGAGAGCTGCCCAGGATTTTTGCCAGTTAGTAGCCCAGCAGCAGAGGAAGCCCACAGATCTGGATGTAGATCTGCTAG
GCAGCTTACTTA
Sequence Type mRNA
Unitrap ID UNI9426

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 52137840..52150022 153
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023068 (Nus1) NM_030250 nuclear undecaprenyl pyrophosphate synthase 1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1196365]

 
Come back to gene ENSMUSG00000023068


For any suggestions or comments, please send an email to unitrap@crg.es