Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST26445
Clone ID OST26445
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST26445
Sequence
AGACAGTGTCCTTCTGGAACAGCGACTGACACTAACAGAAGACAGGCTGAAGCAGTGCCTGGAGAACCAGCAGTTAATCA
TGCAGAGAACGCCACCGTGATGAGGGGAGCAAGGATCAGGAGCTCAGTGATTGGGGGGACAGCAGGCCAGGGATTTGTAT
GGGGACTTGAGTAAATAAATAAAGGGATCCCACCTGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI1421

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106252011..106252208 192
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023345 (Wdr51a) NM_027354 WD repeat domain 51A Gene [Source:MGI Symbol;Acc:MGI:1917485]

 
Come back to gene ENSMUSG00000023345


For any suggestions or comments, please send an email to unitrap@crg.es