Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRD241
Clone ID RRD241
Vector pGT1Lxf
Project baygenomics

Sequence tag RRD241
Sequence
TTGCCAACATGGAAGGTGGAGACAGCACAATTTCCGTAGCAGGCCGTGGGGCTTCGGGTTCCGCAGTAGTGGCGGCGACC
GTGCAGGCGATCCTGCAGGACGACTGTTATAGTGAATTTTTAAATGAAGACTTTGATGTAAAAACTTACACTTCCCAATC
TATTCATCAAGCTGTAATTGCTGAGCAACTAGCAAAACTTGCCCAAGGGATCAGTCAGCTGGATAAAGAACTACACCTAC
AGGTTGTTGCAAGACATGAAGATTTACTGGCACAAGCAACTGGGATTGAGTCTTTGGAAGGTGTTCTTCAGATGATGCAG
ACGAGAATTGGAGCTCTACAGGGAGCTGTTGATAGGATGAAATCAAAGATTGTTGAACCATACAATAAAATAGTAGCCCG
TACTGCACAACTGGCAAGACTTCAGGTTGCCTGTGATTTGCTTCGGAGAATAATTCGCATCTTATATCTCAGTAAGAGGC
TCCAGGGACAACTGCAAGGAGGGAGTAGAGAGATAACAAAAGCTGCTCAGAGTCTCAATGAACTT
Sequence Type mRNA
Unitrap ID UNI9435

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 32339747..32370637 143
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035933 (Cog5) component of oligomeric golgi complex 5 Gene [Source:MGI Symbol;Acc:MGI:2145130]

 
Come back to gene ENSMUSG00000035933


For any suggestions or comments, please send an email to unitrap@crg.es