Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST26136
Clone ID OST26136
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST26136
Sequence
GGACATAAGACTGGCACATGGTCTGCCTGGATAAGTACAGGGGTTTCAGTGTGCATCGTCACCAACGTGGCCTCGCAATG
AGGCAAAACTGACGTAAACTACACTCAGCTAGTCGATCTGCATGCCCGATATGCTGAGTGTGGTTTACGAATCCTGGCCT
TCCCCTGCAACCAGTTTGGGAGGCAGGAGCCAGGAAGTAATCAAGAAATCAAGGAGTTTGCAGCCGGCTACAACGTCAAG
TTTGACATGTACAGCAAGATCTGTGTAAATGGGGACGATGCCCACCCACTGTGGAAATGGATGAAAGTCCAGCCCAAGGG
CANGGGCATGCTGGGAAATGCCATCAAATGGAACTTTACCAAGTTTCTCATTGATAAGAACGNCTGCGTGGTGAAGCGCT
Sequence Type mRNA
Unitrap ID UNI12783

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 45595198..45595595 380
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078449 (AC153368.5)  

 
Come back to gene ENSMUSG00000078449


For any suggestions or comments, please send an email to unitrap@crg.es