Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST25862
Clone ID OST25862
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST25862
Sequence
AAGGTCGGACGAATAGAAGACTTCCTGTACCAACTAGAAGACACGCTTCTTAAAAACTAAGAAACTCAGAACCGCTCGAA
GGCAGAAGACAAAGATGAAGAGACTTCAAACTGTACAGCAAAACTAGACACTAGGAAGCAGGCTGCCTGAAGTGTCTGGA
GAAGTTGGGGTCTGTAGCCTCTGGGTAACAAAGGCTGTCACCCAAGGCCTCAGATGGCACCCTCTTGGCAAAGACAGTCT
ACACTTCATTACTTTCAACTGGTAGCAATAAATATTCTCAACTTGTTGGAC
Sequence Type mRNA
Unitrap ID UNI28614

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 26881840..26882128 282
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039335 (Spata16) NM_027583 spermatogenesis associated 16 Gene [Source:MGI (curated);Acc:Spata16-001]

 
Come back to gene ENSMUSG00000039335


For any suggestions or comments, please send an email to unitrap@crg.es