Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AY0652
Clone ID AY0652
Vector pGT0lxr
Project sanger

Sequence tag AY0652
Sequence
CGCTGCCCGGCACCGACCTGCCCAGCCTGGCTCAGGTCTGCAGCAGGTTCCGCCGAATCTTGCACACGGACACCATCTGG
AGACGGCGCTGCCGCGAGGAGTATGGCGTTTGTGAGAACCTGCGGAAGCTGGAGATCACAGGTGTGTCTTGCCGGGACGT
CTATGCAAAACTGCTTCACCGATACAGACACATTTTGGGGCTGTGGCAGCCAGATATCGGGCCGTACGGAGGATTGCTGA
ACGTCGTGATGGACGGACTGTTCATCATTGGCTGGATGTACCTGCCACCTCATGACCCCCACGTGGGAGACCCCATGCGG
TTCAAGCCACTGTTTAGAATCCATCTGATGGAGAGGAAGTCGGCTACAGTGGAGTGTATGTACGGCCACAAAGGGCCCCA
CAACGGCCACATCCAGATTGTGAAGAGGGACGAGTTCTCCACCAAGTGTAACCAGACAGATCACCACAGGATGTCCGGTG
GGAGGCAGGAG
Sequence Type mRNA
Unitrap ID UNI1025

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 124083812..124102456 170
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031811 (Fbxo31) NP_598526 F-box protein 31 Gene [Source:MGI Symbol;Acc:MGI:1354708]

 
Come back to gene ENSMUSG00000031811


For any suggestions or comments, please send an email to unitrap@crg.es