Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRD059
Clone ID RRD059
Vector pGT1Lxf
Project baygenomics

Sequence tag RRD059
Sequence
ATACAGTGAAGCTGTAGCCAGCCACTACATGAGACAGATACTGGAAGCTCTGCGCTACTGTCATGATAATAACATAATTC
ACAGGGACGTGAAGCCCCACTGTGTTCTCCTTGCCTCAAAAGAAAACTCGGCACCTGTTAAACTTGGGGGCTTTGGGGTG
GCCATTCAGTTAGGAGAATCTGGACTTGTTGCTGGAGGCCGCGTTGGAACACCTCACTTTATGGCCCCAGAAGTGGTCAA
GAGAGAGCCTTACGGAAAGCCTGTGGATGTCTGGGGCTGTGGTGTGATCCTTTTCATCCTGCTCAGTGGCTGTTTGCCTT
TCTACGGAACCAAGGAAAGATTGTTTGAAGGCATTATTAAAGGAAAATATAAGATGAATCCAAGGCAGTGGAGCCATATC
TCTGAAAGTGCCAAAGACCTAGTACGCCGCATGCTGATGCTGGATCCTGCTGAAAGGATCACTGTTTATGAAGCACTGAA
TCACCCATGGCTTAAGGAGCGGGATCGTTATGCCTACAAAATCCATCTTCCAGAAACAGTAGAACAACTGAGGAAATTCA
ATGCAAGGAGAAAACTAAAGGGTGCAGTACTAGCTGCTGTGTCAAGTCACAAATTCAATTCCTTCTATGGGGACCCTCCT
GAAGAGTTGCCAGATTTCTCCGAAGACCCTACCTCCT
Sequence Type mRNA
Unitrap ID UNI9451

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 13177486..13260117 178
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031012 (Cask) NM_009806 calcium/calmodulin-dependent serine protein kinase (MAGUK family) Gene [Source:MGI (curated);Acc:Cask-001]

 
Come back to gene ENSMUSG00000031012


For any suggestions or comments, please send an email to unitrap@crg.es