Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRD065
Clone ID RRD065
Vector pGT1Lxf
Project baygenomics

Sequence tag RRD065
Sequence
AGTAGCATTAGAAAGTTGGCACCAGTCTCCCTCTTGGACACCGACAAAAGGTATTCTGGCAAGACCACTTCTAGGAAAGC
TTGGAAAGAAGACCATTGGGAGCAGGCTCTGCCAAGTTCATCTGATAACGAAGCATCTGATGAGGGAGGATCTGAAGATG
GGGATTCAGAGGGCCTGGGCCTGGAGGAGATCTCAGAAGATGTTGACGAAGACTTAGAAGACAACAAAATATCTGATGAG
GGAGGATCTGAAGATGGGGATTCAGAGGGCCTGGGCCTGGAAGAGTTCTCAGAAGATGTTGAGGAGGACTTAGAAGGTGA
GGATGAGGAAGACAGAGAAGAAGACAGGAACAGTGAAGATGATGGTGTGGTGGCAGCCTTCTCCAGTGTCAAAGTTTCTG
AGGAAGTGGAAAAAGGAAGAGCTGTGAAGAATCAGATAGCATTGTGGGACCAGCTCTTGGAAGGAAGGATCAAGCTACAA
AAAGCTCTCTTGACTACCAATCAGTTGCCTCAACCAGATGTTTTCCCTGTCTTCAAGGACAAAGGTGGCCCAGAATTTGC
CAGTGCTCTGAAAAATA
Sequence Type mRNA
Unitrap ID UNI138

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 84323161..84325766 222
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018697 (Aatf) NM_019816 apoptosis antagonizing transcription factor Gene [Source:MGI (curated);Acc:Aatf-001]

 
Come back to gene ENSMUSG00000018697


For any suggestions or comments, please send an email to unitrap@crg.es