Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRD071
Clone ID RRD071
Vector pGT1Lxf
Project baygenomics

Sequence tag RRD071
Sequence
CCAGGAAGCCAATGTCTGCCAATGTTCCTGCTGCTTCTCCAGCCCCAGGACGGCTTGGTCCTGTGAGCCCAGCTCCATCA
CAGCCCAATTCACAAATTCGACAAAATATAAGGCGCTCCTTGAAAGAGATTTTGTGGAAAAGAGTCAATGACAGCGATGA
CTTAATAATGACAGAAAATGAAGTAGGAAAAATTGCCCTCCACATTGAGAAGGAGATGTTTAACTTGTTCCAGGTTACTG
ATAATCGCTATAAGAGCAAATATCGCAGCATCATGTTCAACCTTAAGGATCCTAAGAATCAGGGGCTCTTCCATCGTGTT
CTTCGAGAAGAAATCTCCTTGGCAAAACTTGTCAGAATGAAGCCTGAAGAACTTGTATCTAAAGAGCTTTCTATGTGGAC
AGAGAAGCCCACAAAATCTGTGATAGAATCCAGGACTAAGTTGCTTAATGAAAGCAAGAAGAACACTACTAAACCAGAAA
CCATTCCTGACATGGAAGATTCTCCACCGGTATCAGATTCAGAAGAACAACAAGAGTCAGTGCGAGCCGCCCCTGAGAAG
AGCGCAGCACCTCTCCTGGACGTCTTCAGCAGCATGCTGAAGGACACCACAAGCCAGCACCGTGCCCATCTTTTTGATTT
AAACTGTAAAATCTGTA
Sequence Type mRNA
Unitrap ID UNI9454

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 180406991..180409814 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038914 (Dido1) NM_175551 death inducer-obliterator 1 Gene [Source:MGI (curated);Acc:Dido1-002]

 
Come back to gene ENSMUSG00000038914


For any suggestions or comments, please send an email to unitrap@crg.es