Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRD099
Clone ID RRD099
Vector pGT1Lxf
Project baygenomics

Sequence tag RRD099
Sequence
TTTTTTCACCTCCCCTCAGACTTCTCCAATGTTGGGGTCTAGTATCCAGACCTTTGCACCTTCCCAGGATGTAAGCAGTG
ACATCCATCCTGATGAAGCAGCAGAAAAGGAGCTGACTTCAGTTGTGGCAGAAAATGGCACTGGCTTGGTAGGCAGCCTG
GAGCTGGAGGAAGAGCACG
Sequence Type mRNA
Unitrap ID UNI9459

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127548223..127548399 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040054 (Baz2a) NM_054078 bromodomain adjacent to zinc finger domain, 2A Gene [Source:MGI Symbol;Acc:MGI:2151152]

 
Come back to gene ENSMUSG00000040054


For any suggestions or comments, please send an email to unitrap@crg.es