Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST24889
Clone ID OST24889
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST24889
Sequence
CGACTAGTGATCCAGAAGACNGGTGGTACACANNGCTGGCCATTGATGTGCTCCACCTGCCCAAAGGACTGAAGGACTTC
TGCAAGTACGAATGAACGAATGAACGCCTGTCTGTGGCCACCAGAGCAAAGTCCCCGGTGGTGCGCCCTGCCTCTAGAGA
AGTGGCTAGACTGAAGCTGGTCGCACAGCTCACAATCAGGGCTGGAAATAAATAGAGCCGATG
Sequence Type mRNA
Unitrap ID UNI14096

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164656244..164656464 209
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039873 (Neurl2) NM_001082974 neuralized-like 2 (Drosophila) Gene [Source:MGI (curated);Acc:Neurl2-001]

 
Come back to gene ENSMUSG00000039873


For any suggestions or comments, please send an email to unitrap@crg.es