Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST24888
Clone ID OST24888
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST24888
Sequence
ACCGGCTGTCTGGTGCGAGCCGTGGAGATGGCCGCCCAGCGCCAGGCGGACATCATCGGGAAGCCTAGCCGCTTCATCTT
CGACTGCGTGTCCCAGGAGTATGGTATCAACCCGGAGCGCACCGTCATGGTGGGAGACCGCCTGGACACAGACATCCTCC
TGGGCTCCACCTGTAGCCTGAAGACTATCCTGACCCTCACCGGAGTCTCCAGTCTTGAGGATGTGAAGAGCAATCAGGAA
AGTGACTGCATGTTCAAGAAGAAAATGGTCCCTGACTTCTATGTTGACAGCATTGCCGACCTCTTGCCTGCCCTTCAAGG
TTAAAGATCTAGTGTCTTTAATCTCTGGAATAAAAAAAAGA
Sequence Type mRNA
Unitrap ID UNI8914

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24608189..24608549 361
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043445 (Pgp) NM_025954 phosphoglycolate phosphatase Gene [Source:MGI Symbol;Acc:MGI:1914328]

 
Come back to gene ENSMUSG00000043445


For any suggestions or comments, please send an email to unitrap@crg.es