Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST24748
Clone ID OST24748
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST24748
Sequence
GTGAATGGTCTCCGAGTGGATCTCCCAGCTACTGTGTTAACATCTGTGTCTGTGAGGAGGATGCCCGACGGCTCCATGCT
TGTCCACCAGAAGGCTGGGGTCACGGTGTGGCTTGGAAAAGATGGGCTTCTGGATGTGATGGTTGGTGATGACCTTGCAG
CCATGCTGTGTGGGGCCTGTGGAAACTTTGATGGGGACCAAACCAACGACGCATATGGTTCTCAGGGGAAGACACCGATA
GAGAAGTGGAGAGCACAGGACTTCTCCCCATGTTCCAACTGATCAGTCACCACTGGCACTGAAGGCATCAAGACCTGCTC
CCTCCCAGAAGTTACAGTGATTGGAAGATGCCCTGTGTGTCCCTTCCCTGTCCCTCCCCCTTTGCTGAGCCACTG
Sequence Type mRNA
Unitrap ID UNI28638

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28905339..28905837 270
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047730 (AC158220.4-201) NP_001116075 Fc fragment of IgG binding protein [Source:RefSeq peptide;Acc:NP_001116075]

 
Come back to gene ENSMUSG00000047730


For any suggestions or comments, please send an email to unitrap@crg.es