Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST24650
Clone ID OST24650
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST24650
Sequence
GATTGAAGAGGAAGCCAGGCAGAAGAAGATGTAGATGCACTGGCCCAGGTGGATCCACAACACCCGAGTATAACATTGAC
CCTGAGGCTTGTGACCTGTTATGGCTCTGTAATTGTGTAAGCTTGAGCGTTTTTATACCCAGCAGCGTAGATTTCATAAT
AAAGTAGTTTGTTGTGGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI28642

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 68367315..68367493 175
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015812 (Gnrh1) NM_008145 gonadotropin releasing hormone 1 Gene [Source:MGI Symbol;Acc:MGI:95789]

 
Come back to gene ENSMUSG00000015812


For any suggestions or comments, please send an email to unitrap@crg.es