Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST24382
Clone ID OST24382
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST24382
Sequence
TCCCCAAACATGACCTAAAATCAGGAGATCTCCCCTTCACTCGGAACAGCCTTGCACCTCTGCCAGACCAAAA
Sequence Type mRNA
Unitrap ID UNI28650

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 113171357..113171427 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049985 (Ankrd55) NM_029898 ankyrin repeat domain 55 Gene [Source:MGI Symbol;Acc:MGI:1924568]

 
Come back to gene ENSMUSG00000049985


For any suggestions or comments, please send an email to unitrap@crg.es