Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST24237
Clone ID OST24237
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST24237
Sequence
GGAGATTTGTACACCCAGGCAGCTGAGGCAGCAATGGAAGCCATGAAGGGCCGGCTAGCCAACCAGTACTACGAGAAGGC
GGAAGAGGCCTGGGCCCAGATGGAGGAATAACTGCCCCACAGAATCACTGCCAAGGAGAAAGGCTGGGGAAGGGAGGATG
GGACTCATTTCTAGGGAGGGGAGAAGCAGTTTTATTATGGTATAAACTCACTTTTGTA
Sequence Type mRNA
Unitrap ID UNI13342

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 128046795..128047012 218
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035064 (Eef2k) NM_007908 eukaryotic elongation factor-2 kinase Gene [Source:MGI (curated);Acc:Eef2k-001]

 
Come back to gene ENSMUSG00000035064


For any suggestions or comments, please send an email to unitrap@crg.es