Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST24070
Clone ID OST24070
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST24070
Sequence
GAGGACTCCTGATGGATTTGACTCGGTGCCGCTGAAGACGTCTTCAGGAGGCCCAGACATGGACATGTGAGAGGTGCCCG
TCCTGCCTCGCCTGCCTCCTCACCTGGGCACACTACCCTGCAGGCCTGTGGCAGTTTAGGTGCCAGCAACCCTGCGCTCC
CCGCTGCTGGGAATCTCTTCATTGTGGCCTTATCAGAAGTTTGGATTTCAGACCCTTGTTTTTTATAGAGTACCCAAACC
TGTCTCTACGCTTGCCTCAAGCCTACCAAATATACCCACACTTCGTGTACTGTTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI28399

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 108261094..108261387 294
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040412 (5330417C22Rik) NM_001033304 RIKEN cDNA 5330417C22 gene Gene [Source:MGI Symbol;Acc:MGI:1923930]

 
Come back to gene ENSMUSG00000040412


For any suggestions or comments, please send an email to unitrap@crg.es