Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST24006
Clone ID OST24006
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST24006
Sequence
GGGAAACTGGATTCCAAGATCCATCAAGGAGCAAAGAAGGGGTTAATGAAGCAGAATAAAGCTGTCTGACCCAGGAAAAA
AGGAACTATACAACATAANGGAGNCTTGTGTACTANNGTGCTATCCGCTGGGCCTTTGGGATTGAAGCAGTAGAAAGCGA
AAAGGCTGGGCACCAGGCTTCAATCTCTGAGAATCTAAACTCTTACCAAATCTGTGTATTTTTCTTAAAGGATGGAATTC
TTTATGAAGTGGGTTACAGATCTTTGAATATGTTATTTATAAAAAAATCATTTTAAAAATAATAA
Sequence Type mRNA
Unitrap ID UNI28671

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 65680957..65681256 290
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032386 (Trip4) NM_019797 thyroid hormone receptor interactor 4 Gene [Source:MGI (curated);Acc:Trip4-001]

 
Come back to gene ENSMUSG00000032386


For any suggestions or comments, please send an email to unitrap@crg.es