Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RST355
Clone ID RST355
Vector pGT2TMpfa
Project baygenomics

Sequence tag RST355
Sequence
TTTGTAAGTTCCTGTCTGAATCTGAGCCTGAAAGAAGGTTTCTCTGCGGTGTGTCCTGAGTGCCTCTGCTGGGTGCTGTG
AGGGAGCTCTGAAAAGCTTAAAATTTCCGGACAT
Sequence Type mRNA
Unitrap ID UNI7604

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 150310717..150310828 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074731 (Zfp345) NP_001030072 zinc finger protein 345 Gene [Source:MGI (curated);Acc:Zfp345-001]

 
Come back to gene ENSMUSG00000074731


For any suggestions or comments, please send an email to unitrap@crg.es