Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RST059
Clone ID RST059
Vector pGT0TMpfs
Project baygenomics

Sequence tag RST059
Sequence
CACACCCTTTTCCGGTCCGGGCTGCCCGACCGCTCTTGCTGCTGCCGGTGGATGCTGCGCCTCTCGGAGCGCAATATGAA
GGTGCTCTTCGCCGCCGCCCTCATNGGTGGGCTCCGTCGTCTTCCTTTTGCTGCCCGGACCCTCCGTGGCCAACGATAAG
AAGAAGGGACCTAAAGTCACAGTCAAG
Sequence Type mRNA
Unitrap ID UNI9491

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 65908022..65908207 181
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032383 (Ppib) NM_011149 peptidylprolyl isomerase B Gene [Source:MGI Symbol;Acc:MGI:97750]

 
Come back to gene ENSMUSG00000032383


For any suggestions or comments, please send an email to unitrap@crg.es