Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST23678
Clone ID OST23678
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST23678
Sequence
GTGCAGCTGTGTTCTCCGGGGCACTCATCTATGCCATCCACACCGAGGAGATCCTGGCCAAGCACCCGAGTGGGGGCAGC
TTCGGTTACTGCTTCGCCCTGGCCTGGGTGGCTTTTCCACTCGCTCTGGTCAGCGGCATTGTCTACATCCACCTGCGGAA
ACGTGAATGAGCACTGTGTCCCCTAGAAAATAAATTCATTTAACCACGA
Sequence Type mRNA
Unitrap ID UNI28684

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 53173397..53173605 207
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040212 (Emp3) NM_010129 epithelial membrane protein 3 Gene [Source:MGI Symbol;Acc:MGI:1098729]

 
Come back to gene ENSMUSG00000040212


For any suggestions or comments, please send an email to unitrap@crg.es