Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RST288
Clone ID RST288
Vector pGT0TMpfs
Project baygenomics

Sequence tag RST288
Sequence
CATGGAGCTCCGGGCAGTCGGTTTCTGCCTGGCGCTGCTGTGGGGTTGCGCGCTGGCGGCCGCGGCGGCACAGGGAAAGG
AAGTTGTTTTGTTGGACTTCGCAGCAATGAAGGGAGAGCTCGGCTGGCTCACGCACCCCTATGGCAAAGG
Sequence Type mRNA
Unitrap ID UNI9498

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 140857267..140862495 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006445 (Epha2) NM_010139 Eph receptor A2 Gene [Source:MGI (curated);Acc:Epha2-001]

 
Come back to gene ENSMUSG00000006445


For any suggestions or comments, please send an email to unitrap@crg.es