Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AY0423
Clone ID AY0423
Vector pGT0lxr
Project sanger

Sequence tag AY0423
Sequence
TAGCTCCTCAGTCTTTTATTCAGTCCTTGCCCTACTTTTCCACACCTCTATCCTTACTCTAGCTCGTTTCATTTCTATTA
GCGTTGTTCTTATTCCAATTTCTTCATTCTCCTGAGTCCCCCTCTATACTTCCGCCTCCTTTTCTTTATCTATTCCCTCT
ATATCTTCGATTTCTCCTTTCCTTTAGTCCTTTGTCTTACTTTAGTCTACCTTCTACTCCTCTTCACTCTTTTATGCCCG
TTGCTCTTATATTTCCCTCGCTAGTTTCTTTTTCTTTTTCTTTCCTTGCTCTTCCACCATTCTCTTTATCTTTTTTCCAT
CCATCTTTTCTTTTTTTTCCTATATCCCTATAATCTGGCTGCATTCTTATTTTATTCCCTTTCTGCTACCAAATTCCGAA
ATCATGTCATGGAAGGAGACTGGGATAAGGCAGAGAATGACCTGAATGAGCTAAAGCCTTTAGTGCATTCTCCTCACGCT
ATTGTG
Sequence Type mRNA
Unitrap ID UNI1034

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 183139182..183594045 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038733 (Wdr26) NM_145514 WD repeat domain 26 Gene [Source:MGI Symbol;Acc:MGI:1923825]

 
Come back to gene ENSMUSG00000038733


For any suggestions or comments, please send an email to unitrap@crg.es