Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST23224
Clone ID OST23224
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST23224
Sequence
TTTACAGAAGCAGCACAGAATCCCACAGAGACTTGGAAGCCAGTTTATCAGAAAGAAAACAGGACCCCAAAGCTACCACA
GGCTCATGAAGTCCCTGAAGAAAGTGACCACCGTACCCACAGATCGTCTTCATTGGCCAGCAGTTCCCTCCAAGACATCT
GGAGGCTGCTAGAGCTGGGATCCAGCCCTTCGGGCGTCCCCTCACAGGATAACTCTGTTGCAGAGTGTCCAGCACCTTCA
AGACCCAGCTGTTTCCAAAAGGTCAACCGGAGCCCTGTCCCCATACAAAAGGCCTTTGCTGTCAAAGGGCTAAAGATGGA
AGCTCAGCCAAAAGCCACACCCCCCAGACCCAGCAAGTCTCACCCAGCTAAACCTACAAACTGCCAGCAGCAGCGGCCCT
CTAGGATCCGCAACTACAACCTCAAGGACTAAGTCTCAGCCTCCTGCAGGAGACTGCACAGGGGCTCCACCTTGTACGTG
GGGCCTGTGGTTATACAAGTTGGGAGTGAGAATACACATGGTATACAGGTGGGTTGTGAAGCCCAGGACAGCATTCCAAA
TGAATGGCCTTTCTTGATGCTAAAGAGCAATTAAAGCCTTCTTCATCTGGT
Sequence Type mRNA
Unitrap ID UNI28697

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 120687856..120721935 369
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048445 (Ccdc57) NM_027745 coiled-coil domain containing 57 Gene [Source:MGI (curated);Acc:Ccdc57-001]

 
Come back to gene ENSMUSG00000048445


For any suggestions or comments, please send an email to unitrap@crg.es