Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST23183
Clone ID OST23183
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST23183
Sequence
GGAGCCCTTGCCCAGAGCTGCTTCTCTGGCGCTATCCCGGGAGCCTGATTCCTGAAGCCCTCAGGCTGCTGAGGCTGGGA
GATACCCCCAGTCCCTACTACCCTGCGTCCCCAGCTGGGGATATCGTGGAGCTCTGAGTATTGATGGCCTGTGTCCCTCC
CTATCTTCTTTCTGACAACAAAGACCAGCAACTCCCAGAAAGGGATGAAGTCCTTCTGCAAACCTGGCCACCAGGACCTT
CCCTCTGACAAGAGGACACTAGCTCGGTGGAACCCTCAGTGAAAGGCAGCCTGGGAAAGGGAAAATGTTACCCCATTAGT
GAATAAAGACCTGTGAGCAGTTGAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI25594

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 23811850..23812194 343
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023904 (Hcfc1r1) NM_181821 host cell factor C1 regulator 1 (XPO1-dependent) Gene [Source:MGI Symbol;Acc:MGI:2663619]

 
Come back to gene ENSMUSG00000023904


For any suggestions or comments, please send an email to unitrap@crg.es