Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST23167
Clone ID OST23167
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST23167
Sequence
AGGTGCACTCAAGCCATGAAACTTCATGCTGGAGAACAGTGATGCCCCAGAGGCTATGACATGAAATAAAAGATGCAGCC
CAA
Sequence Type mRNA
Unitrap ID UNI14107

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40878342..40878424 83
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028415 (Spink4) NM_011463 serine peptidase inhibitor, Kazal type 4 Gene [Source:MGI (curated);Acc:Spink4-001]

 
Come back to gene ENSMUSG00000028415


For any suggestions or comments, please send an email to unitrap@crg.es