Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRA055
Clone ID RRA055
Vector pGT1Lxf
Project baygenomics

Sequence tag RRA055
Sequence
ACGGTTTTTTTGTCCAAGGTTTTCCTAAACTCTTGAGATTTCAAGAACATCATGAGAAAATTCTGAACAAATTTTTGTCC
AAACTTAAGCAGCACTTGGATTCTCAAGAAATCTACACAAGTTTTTACTCAATGAAATGGTTTTTTCAGTGTTTCCTTGA
TCGAACTCCCTTCAGGCTGAACCTCAGGATATGGGACATCTATATCTTTGAAGGAGAGCGAGTCCTTACTGCTATGTCTT
ACACAATCTTGAAACTACACAAAAAGCATCTGATGAAGTTGTCTATGGAAGAACTTGTAGAATTTCTTCAGGAGACTCTC
GCCAAGGATTTTTTCTTCGAGGATGATTTTGTAATAGAGCAACTTCAAGTTTCTATGGCAGAACTAAAGCGGGCAAAGTT
AGATCTCCCAGAGCCT
Sequence Type mRNA
Unitrap ID UNI9509

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 6347940..6351623 152
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039046 (Usp6nl) NM_181399 USP6 N-terminal like Gene [Source:MGI (curated);Acc:Usp6nl-001]

 
Come back to gene ENSMUSG00000039046


For any suggestions or comments, please send an email to unitrap@crg.es