Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRA064
Clone ID RRA064
Vector pGT1Lxf
Project baygenomics

Sequence tag RRA064
Sequence
CTGGGCTGAACCCAGAGCCAGAAAAGAGTCGGTTCTGAGTTCCCTGTGGGTGTGCGGCCGCCGCGGAGGGGAACATGGCG
CTCGTGGGCAGCCGGGTGGAATTGGACGCGGACGAGGATATCTTTGAAGATGCCTTGGAGACCATCTCT
Sequence Type mRNA
Unitrap ID UNI9513

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 82943834..82970090 115
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038172 (Ttc39b) NM_027238 tetratricopeptide repeat domain 39B Gene [Source:MGI Symbol;Acc:MGI:1917113]

 
Come back to gene ENSMUSG00000038172


For any suggestions or comments, please send an email to unitrap@crg.es