Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRA094
Clone ID RRA094
Vector pGT1Lxf
Project baygenomics

Sequence tag RRA094
Sequence
GGCAGAGGAGGAGGCAGAAATAAAGTTGGTGTGCCGGTCTTGTGCGGAGATTGGAGGCGTCCTTGCGGGCTCCGGCCCGG
AGAGGGGGGGTGTCGGCGTTGGAGTTGTGAATTCGCTGCGTTTCCATGAAATCCTGCGGAGTGTCGCTCGCTACCGCCGC
CGCCGCCGCCGCCGCCGCCGCTTTCGGTGATGAGGAAAAGAAAATGGCGGCGGGAAAAGCGAGCGGCGAGAGCGAGGAGG
CGTCCCCCAGCCTGACAGCGGAGGAGAGGGAGGCGCTCGGCGGACTGGACAGCCGCCTTTTCGGGTTCGTGAGGTTTCAT
GAAGATGGCGCCAGGATGAAGGCCCTGCTGGGCAAGGCTGTTCGCTGCTACGAATCTCTAATCTTAAAAGCTGAAGGGAA
AGTGGAGTCTGATTTCTTTTGTCAATTAGGTCACTTCAACCTCTTATTGGAAGATTATCCAAA
Sequence Type mRNA
Unitrap ID UNI8799

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 17740007..17776390 292
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037369 (Utx) NM_009483 ubiquitously transcribed tetratricopeptide repeat gene, X chromosome Gene [Source:MGI (curated);Acc:Utx-001]

 
Come back to gene ENSMUSG00000037369


For any suggestions or comments, please send an email to unitrap@crg.es