Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRA128
Clone ID RRA128
Vector pGT1Lxf
Project baygenomics

Sequence tag RRA128
Sequence
AAAAGTTCTTGGCAGTCCTGGTAGAGGACCAATTAAGACTGTAACTGGAGGTGGAATGGCTGTTACCCGGACTATTCCTT
CTTTGACGCTGACATCAACACCTCTTAGATCAGGATTATTAGAAAACCGCACTGAAAAGAGGAAAAGAATGTTA
Sequence Type mRNA
Unitrap ID UNI9531

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 74532605..74533321 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033364 (Usp37) NM_176972 ubiquitin specific peptidase 37 Gene [Source:MGI Symbol;Acc:MGI:2442483]

 
Come back to gene ENSMUSG00000033364


For any suggestions or comments, please send an email to unitrap@crg.es