Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST22604
Clone ID OST22604
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST22604
Sequence
AAGCAGCTCGGCAATGATGTCATCTCCCAGGATCCTTCCAGCCCAGTCTCGTGCAACACAGAGCGTTTAGAAGGAGGGGC
GACAGTGCCTAAACTGCAACCAGGTCTTCCAGAGGCCCGCTTTGGTTCGGGAACACCAGAAAAGAATGCCAAAGCTGAAC
CCAGAGTGGATGGAGGCTGCAGGTCCCGGAGCTCCTCCAGCATGCCCACCAGCCCAAAGCCCCTCCTTCAGTCCCCTAAG
CCCAGCCCTTCAGCCCGGCCTTCTATCCCTCAGAAGCCAAGAACTGCCTCCCGACCTGAAGACACCCCAGACTCTCCATC
TGGTCCTAGTTCCCCTAAAGTTGCCCTCCTTNCACCCATNCTTAAAAAANGCTTCTTCGGACAAGGAGCGTGACGGCCAG
AACAGCTCACAGTCCAGTCCTAGGAGCTT
Sequence Type mRNA
Unitrap ID UNI28722

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 24114376..24117806 215
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021338 (Lrrc16a) NM_026825 leucine rich repeat containing 16A Gene [Source:MGI (curated);Acc:Lrrc16a-001]

 
Come back to gene ENSMUSG00000021338


For any suggestions or comments, please send an email to unitrap@crg.es