Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST22569
Clone ID OST22569
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST22569
Sequence
TGACTCTGCTGCCAAAGAAGCCCTGCAAGTCCAAGGCCAAGGGGTTACTGCTGGGAGCTCTCTTCACCAGTTTCCTATTG
CTGCTGTACTCCTATGTGGTACCTCCACTGTATCCCAACATGGCCTTCACGACCTCAGAGGCTGCAGCACCCTGCTCCCC
TATTCCCAATGAGCCAGTGGCAGCCACTCCCGCCAACGGCTCAGCAGGAGGGTGTCAACCTCGGCGAGATATTGTGTTCA
TGAAGACGCACAAGACCGCCAGCAGCACACTGCTCAACATCCTGTTCCGCTTCGGCCAGAAGCACGAGCTCAAGTTCGCT
TTCCCCAATGGCCGNAACCAATTTCCNCTACCCGTCGTACTTTGCACGAAGCCTGGTGCAGGACTACCGGCCTGGGGCGT
GCTTCAACATCATC
Sequence Type mRNA
Unitrap ID UNI28723

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 3896925..3898211 275
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049721 (Gal3st1) NM_016922 galactose-3-O-sulfotransferase 1 Gene [Source:MGI (curated);Acc:Gal3st1-001]

 
Come back to gene ENSMUSG00000049721


For any suggestions or comments, please send an email to unitrap@crg.es