Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XE365
Clone ID XE365
Vector pGT1Lxf
Project baygenomics

Sequence tag XE365
Sequence
GGAGCGACAGCGACGCAAGATGGCAGCCACCACAGGCTCG
Sequence Type mRNA
Unitrap ID UNI2026 UNI2027

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 167457441..167457479 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078923 (Ube2v1) NM_023230 ubiquitin-conjugating enzyme E2 variant 1 Gene [Source:MGI (curated);Acc:Ube2v1-003]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 60680929..60680967 39
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027694 (AC122503.4)  

 
Come back to gene ENSMUSG00000027694


For any suggestions or comments, please send an email to unitrap@crg.es