Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XE370
Clone ID XE370
Vector pGT1Lxf
Project baygenomics

Sequence tag XE370
Sequence
AGCCTCCCCTCCCCTTCCCCGTCTCCTCCTCTCCCTTGGAGAGCCCGGGCAGGCACTGCCCTGCAGCCCCAGTGACAGGA
GGAGACCATACTCCCCGACAGCGCCATGGCCCAGATTCTGCCCATTCGCTTTCAGGAGCATCTCCAGCTCCAGAACCTGG
GTATCAACCCAGCAAACATTGGCTTCAGTACCTTGACTATGGAGTCAGACAAATTCATCTGCATTAGAGAAAAAGTGGGA
GAGCAGGCCCAGGTGGTAATCATTGATATGAATGATCCAAGTAATCCAATTCGAAGACCAATCTCAGCAGACAGTGCCAT
CATGAATCCTGCCAGCAAAGTGATTGCACTGAA
Sequence Type mRNA
Unitrap ID UNI5782

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86550575..86570896 209
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047126 (Cltc) NM_001003908 clathrin, heavy polypeptide (Hc) Gene [Source:MGI (curated);Acc:Cltc-001]

 
Come back to gene ENSMUSG00000047126


For any suggestions or comments, please send an email to unitrap@crg.es