Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST22199
Clone ID OST22199
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST22199
Sequence
GGAATTTTTACGTGGTGAGAAGTGCCTGGATCAGCTAATTGAGAGATTGCTTCAATCAGCAGATGAAGAGGCCATTTCCG
AATTTTTGGATGAAAGCCTTCAATCAGTGAAATAAATTATTTGTTATATAAATGAAGTGGACTTTGATCAAGAATAAAAA
GGGNGNGGAAATCNTAATAACTATTCATAAACG
Sequence Type mRNA
Unitrap ID UNI28731

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 79823203..79823393 179
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022022 (Mtrf1) NM_145960 mitochondrial translational release factor 1 Gene [Source:MGI Symbol;Acc:MGI:2384815]

 
Come back to gene ENSMUSG00000022022


For any suggestions or comments, please send an email to unitrap@crg.es