Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XE390
Clone ID XE390
Vector pGT1Lxf
Project baygenomics

Sequence tag XE390
Sequence
GATCGCAGCAGGCAGGGGGGAGGTGCGAGAGGGTTCGAAGGGACAGGTCCGGGCAGCGATCGGGGGTTGGCACCAGTTCG
CTCACCCTTCGAGAGGCAGAGCGCTCTTGTCCGCAATCTTCGCTGACCGCGCTAGCTGCGGCTTCTGTGCGCCTTCATTC
GGACCTTAGCAGCCAGCGTCCTGGCGTCTGACCCCGCCATGCCTAGCCTCTGGGATCGTTTCTCGTCCTCCTCTTCCTCT
TCGTCCTCGTCTCGAACTCCGGCCGCTGATCGGCCGCCGCGCTCCGCCTGGGGGTCTGCAGCCAGAGAAGAGGGCCTTGA
CCGCTGCGCGAGCCTGGAGAGCTCGGACTGCGAGTCCCTGGACAGCAGCAACAGTGGCTTCGGGCCGGAGGA
Sequence Type mRNA
Unitrap ID UNI9542

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 59414067..59414582 255
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020108 (Ddit4) NM_029083 DNA-damage-inducible transcript 4 Gene [Source:MGI Symbol;Acc:MGI:1921997]

 
Come back to gene ENSMUSG00000020108


For any suggestions or comments, please send an email to unitrap@crg.es