Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XE395
Clone ID XE395
Vector pGT1Lxf
Project baygenomics

Sequence tag XE395
Sequence
TGAAAAAAGTTTTCAAAAATGGATGGGGTATATTCAGAAGCTAATGAAGAGAATGACAATACACAGAGACCTGTTAGAAG
ACAGCATTCCTCAATTTTGAAACCCCCAAGGAGTCCTCTTCAGGACCTCAAATGTGGAAATCAAACAAACCAGGAACCTA
ATCCTCCAAGAAAAAGGAAAAGCTCTCGTCGAGTCAGCTTTGCAGATACTATAAAAGTATTCCAGACAGAGTCTCACATG
AAAACAGAGAGAAATTCAGAAATTT
Sequence Type mRNA
Unitrap ID UNI9543

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 118883016..118889830 64
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027326 (Casc5) NM_029617 cancer susceptibility candidate 5 Gene [Source:MGI (curated);Acc:Casc5-004]

 
Come back to gene ENSMUSG00000027326


For any suggestions or comments, please send an email to unitrap@crg.es