Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST22099
Clone ID OST22099
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST22099
Sequence
CACAGCTGGCCACCAGCTCCTTCCTGCTCTTCTTGCTGGCAGGCGTCATCTCTGTGGCCTTCCTGCTCCTACCACTGCAG
GATGAGCTTGGCAGCCAGCTGCCTCAAGTCCTGCACGTGTCCCTGGGACAGAAGCTGGNTGCGGCCTACGTCTTAGGCCT
CCTCACCATGGTGCTCCTCCGGACCTGAACTCTCAGCTGAACCCACCTCACCCACCCTCTCCTTCGCAGGCAGGGACCTA
AGGCAGCCACTGTGATGTTTGCACCTTGCTCCTCCTCCCTCGCTTCCGCCCATCCGTTGCTCCTCCTCCCTCGCTTCCGC
CCATCCGTTGCTCCTCCTCCCTCGCTTCCGCCCATCCGTTGCTCCTCCTCCCTCGCTTCCGCCCATCCGTTGCTCCTCCT
CCCTCGCTTCGCCATCCGTTGATTGTCAGCCTCCCACAAGCAAGCACCTGGGATTTGTACTCATTTTCCAAGTTGATTAA
AAATACATTTTA
Sequence Type mRNA
Unitrap ID UNI13008

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 138038015..138038532 259
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037221 (Mospd3) NM_030037 motile sperm domain containing 3 Gene [Source:MGI (curated);Acc:Mospd3-001]

 
Come back to gene ENSMUSG00000037221


For any suggestions or comments, please send an email to unitrap@crg.es