Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST22030
Clone ID OST22030
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST22030
Sequence
GCTTTTAGCCAAAAATCAATGAACCAGTAAGTTGCATTCGAAACGGAGGCATATGCCAGTATCGGTGCATTGGCCTTAGG
CATAAGATTGGAACTTGTGGATCTCCTTTCAAATGCTGCAAGTGATAATAGAGAAGACAAAGATCCTGCAAACCAAAGAA
AACACCAGAATTTTTTCCTCCATGAAGATGGACAAAACTTAAACCAAATTAAAGTTTCTTGATTAAATGCAAA
Sequence Type mRNA
Unitrap ID UNI28734

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 19445749..19445985 213
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031471 (Defb8) NM_153108 defensin beta 11 Gene [Source:MGI (curated);Acc:Defb8-001]

 
Come back to gene ENSMUSG00000031471


For any suggestions or comments, please send an email to unitrap@crg.es