Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone XE409
Clone ID XE409
Vector pGT1Lxf
Project baygenomics

Sequence tag XE409
Sequence
TAGGGCGGGATACCTTCGCTCAGCATGGCGGCGATTCCCCCAGACACCTGGCAGCCGCCCAACGTCTACCTGGAGACTAG
CATGGGAGTCATTGTCCTGGAGCTATACTGGAAGCATGCGCCCAAGACCTGCAAGAACTTCGCGGAGCTGGCTCGGCGGG
GCTACTACAATGGCACCAAGTTCCACAGGATCATCAAGGACTTCATGATCCAAGGCGGCGACCCGACAGGCACAGGTCGA
GGTGGCGCATCTATTTATGGCAAACAGTTTGAAGATGAGCTTCATCCA
Sequence Type mRNA
Unitrap ID UNI9547

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29389211..29400894 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024007 (Ppil1) NM_026845 peptidylprolyl isomerase (cyclophilin)-like 1 Gene [Source:MGI (curated);Acc:Ppil1-001]

 
Come back to gene ENSMUSG00000024007


For any suggestions or comments, please send an email to unitrap@crg.es