Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST21974
Clone ID OST21974
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST21974
Sequence
GTTCTGTGGAAGCCCTGCAGGAGGTTCTACAGCTGCCTGCTGCCCTGCGTGCCTGCCCACCCCTTCAGGCGGCGTTGGCT
GTTGACGCTGCCTTCCGGGAAGACAACCATGCCCGACTGTTTCGCCTGCTTCGCACCTTACCCTACCTACAGAGCTGCGC
AGTGCAGGAACACATTGGGTATGCCCGCCGCAAAGCTCTAGCCCGCCTGTCCCGTGCCCTGAGCACTCCTAAGGGACAGA
CCTTGCCTTTGGACTTCATAGAACACTTTCTGGCCCTGGATGGACTCCAGGAAGCACGGGACCTGTGCCAGGCCCATGGA
CTGACCTTGGATAAAGACAGAGTTGTATTCCTGAGGGGTCAATACTCTGAGGAAGGACTCCCACCCCCTGGTGCCTACCA
CATATTAGTGGGGAATAAGTTGCAGGGACACACCCTGGAAGATGTGGGCATGGCT
Sequence Type mRNA
Unitrap ID UNI13053

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 6116133..6116587 453
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024790 (Sac3d1) NM_133678 SAC3 domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1913656]

 
Come back to gene ENSMUSG00000024790


For any suggestions or comments, please send an email to unitrap@crg.es