Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST21900
Clone ID OST21900
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST21900
Sequence
CCTGCTACCAATATCCCCTCCAGTTCAGGATTAAAGAGACAGAGTGTACTTCCACCCAGGAGAGACAGCCTAAAGACTGC
GACTTCCTGGAGGATGGGGAGGAGAGAAATTGCACAGGGAAATTCTTCAGAAGGCGGCAGTCAACCTCCCTGACCTTGAC
CTGCGACAGGGATTGCAGTCGAGAGGATACCCAAGAAACCAGTTTTAATGATAAGCAAGACGTCTCTGAAAAGGAAAAGT
TCGAAGATGTGCCCCCTCACATCAGGAACATTTATGAAGATGCCAAGTATGATATCATCGGCAACATCCTGAAAAATTTC
TAGGGCTGGAAAGAGGAGGGAGGTGCTCCCTGCATACTATGACCTCCTCTTTACCTCCACTACCCATCTCCCCCTGCTGC
ATTCAGGATCTGCCCCTTCTTCCTGCCTTTCCAGGGAACACCCCTCTAAAG
Sequence Type mRNA
Unitrap ID UNI13749

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 110323320..110325042 255
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032484 (Ngp) NM_008694 neutrophilic granule protein Gene [Source:MGI (curated);Acc:Ngp-001]

 
Come back to gene ENSMUSG00000032484


For any suggestions or comments, please send an email to unitrap@crg.es