Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST21756
Clone ID OST21756
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST21756
Sequence
TGGACTTCATTACCTACATGGACGAGCTCACTCAGTGCATAGGCGCGAAGCCCAGCATTCCACTTTTGNTCATTAAGGAT
CCAAGATTGGCTTGGGAAGTTTTCTTTGGACCATGTACCCCTTACCAATACCGCCTAGTGGGCCCTGGAAGATGGGATGG
AGCCAGAAATGCCATCCTGACACAGTGGGACAGGACTCTGAAACCATTAAAAACTCGAATTGTTCCTAAAA
Sequence Type mRNA
Unitrap ID UNI28743

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 164724264..164724492 227
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026692 (Fmo4) NM_144878 flavin containing monooxygenase 4 Gene [Source:MGI (curated);Acc:Fmo4-001]

 
Come back to gene ENSMUSG00000026692


For any suggestions or comments, please send an email to unitrap@crg.es